Welcome international healthcare professionals

This site is no longer supported and will not be updated with new content. You are welcome to browse and download all content already included in the site. Please note you will have to register your email address to access the site.

You are here

Combined stimulation of TLR9 and 4.1BB augments Trp2 peptide vaccine-mediated melanoma rejection by increasing Ag-specific CTL activity and infiltration into tumor sites

Cancer Letters, 2, 330, pages 190 - 199

Highlights

► Trp2 peptides plus CpG-oligodeoxynucleotide treatment in combination with anti-4.1BB Abs dramatically increases antitumor cure rates. ► Trp2 peptides plus CpG-oligodeoxynucleotide treatment in combination with anti-4.1BB Abs augments Ag-specific CD8+ CTL responses. ► The augmented Ag-specific CD8+ CTLs are associated with their subsequent infiltration into the tumor sites. ► Trp2 peptide-mediated tumor eradication requires combined stimulation of TLR9 by CpG-oligodeoxynucleotide and 4.1BB by anti-4.1BB Abs.

Abstract

Peptide vaccines are a clinically applicable therapy shown to be effective in tumor control. In this study, Trp2 peptides plus CpG-oligodeoxynucleotide treatment was found to induce Ag-specific IFN-γ and CD8+ CTL responses, and antitumor activity against large established melanoma (tumor size, 7 mm). A combination of anti-4.1BB antibodies with Trp2 peptides + CpG-oligodeoxynucleotide increased the antitumor cure rate from 0% to 75%. This effect was concomitant with greater induction of Ag-specific CD8+ CTLs and their infiltration into the tumor sites, highlighting the importance of combined stimulation of TLR9 and 4.1BB for achieving tumor eradication. These findings may have implications for designing peptide-based therapeutic vaccines for cancer-patients.

Keywords: 4.1BB, Melanoma, Peptide vaccines, TLR9.

1. Introduction

Melanoma is a malignant cancer of the melanocyte, which is found mainly in the skin. The incidence of this malignancy has been increasing yearly, and the prognosis for metastatic melanoma is still quite poor. Furthermore, therapy for this disease is complicated by its higher rates of metastasis and resistance to many chemotherapeutic drugs [1] and [2]. However, numerous preclinical and clinical studies have shown that immune-based therapies might be beneficial for treating melanoma. For example, tumor infiltrating lymphocytes (TILs) expanded ex vivo and then delivered to patients with melanoma are effective at removing tumor masses [3] and [4].

The proteins involved in the synthesis of melanin, such as tyrosinase-related protein (Trp) 1, Trp2 and glycoprotein (gp) 100, can be recognized as melanoma antigens by human and mouse T cells [5], [6], [7], [8], and [9]. In B16 mice, the MHC-I binding peptides, Trp2180–188 and gp10025–33 have been extensively studied and are considered to function as immunodominant CD8+ T cell epitopes [7] and [8]. In preclinical trials, enhanced antitumor immunity was demonstrated by combining these peptides with toll-like receptor (TLR) agonists [poly (I:C) and CpG-oligodeoxynucleotide (ODN)] as adjuvants and using antibodies, such as anti-CD25 Abs and anti-CD40 Abs [10], [11], and [12]. Intravenous delivery of Trp2 peptides, poly (I:C) and anti-CD40 Abs augmented Ag-specific CD8+ CTL responses and B16 melanoma tumor control [12] . A combination of subcutaneous injection of Trp2 peptides with intramuscular injection of poly (I:C) also increased Ag-specific CTL responses and improved survival in B16 tumor-bearing mice [13] . These collective studies highlight the importance of targeting immune stimulatory molecules in conjunction with using peptide vaccines to induce Ag-specific immune responses for tumor control.

4.1BB (CD137) is a member of the tumor necrosis factor (TNF) receptor superfamily, and is an inducible protein expressed on the surface of activated T cells, but not resting T cells [14] and [15]. 4.1BB activation provides a potent costimulatory signal to CD8+ T cells and, to a lesser extent, CD4+ T cells [16] . In immunotherapy studies, agonistic anti-4-1BB Abs can enhance tumor rejection, increase tumor-specific cytotoxicity, and may render effector T-cells resistant to Treg suppression [17], [18], [19], [20], and [21]. Moreover, administration of anti-4-1BB Abs results in regression of established subcutaneous and pulmonary P815 mastocytoma and AG104A sarcoma [21] , but not for poorly immunogenic tumors, such as B16 melanoma [17] and [18]. Recently, intratumoral administration of an oncolytic virus combined with systemic delivery of anti-4.1BB Abs resulted in increased antitumor therapeutic activity through possible involvement of CD8+ T cells, NK cells, neutrophils, and IFN-γ [22] . Based upon these previous studies, it can be speculated that combined activation of TLR and 4.1BB might break immunologic tolerance to certain self-peptides and lead to activation of self Ag-specific CD8+ T cells, thus resulting in better tumor control in the B16 model.

2. Materials and methods

2.1. Mice and tumors

Female 6 week old C57BL/6 mice were purchased from Daehan Biolink Co., Chungbuk, Korea. The mice were cared for under the guidelines of the Institutional Animal Care and Use Committee-approved protocols. B16 BL6 cells (C57BL/6 background) were purchased from the Korean Cell Line Bank (Seoul, Korea), and grown in complete DMEM medium (10% FBS, 1% l-glutamine, 1% penicillin/streptomycin). The tumor cells were washed 2 times with phosphate-buffered saline (PBS) and injected into the mice.

2.2. Reagents, DNA construction and immunization

To produce pB16 and pSig/B16/LAMP, a codon-optimized DNA sequence coding for three peptides (AGCGTGTACGACTTCTTCGTGTGGCTG for Trp2180–188, ACCTGGCACCGCTACCACCTGCTG for Trp1222–229 and GAGGGCAGCCGCAACCAGGACTGGCTG for gp10025–33) with four amino acids between each peptide, as well as Xho I and Pst I digestion site sequences upstream of the peptide DNA sequence and EcoR I and Bam HI digestion site sequences downstream of the peptide DNA sequences was synthesized by Bioneer (Taejon, Korea). Specifically, one initiation codon (ATG) was introduced into the sites in between the Xho I and Pst I sites, while one termination codon (UAG) was introduced into the sites in between the Eco RI and Bam HI sites. To generate pB16, the above synthetic DNA sequence was digested with Xho I and Bam HI, and then the resulting Xho I and Bam HI DNA fragments were cloned into the Xho I and Bam HI DNA fragments of pcDNA3.1(−) ( Fig. 1 ). To generate pSig/B16/LAMP, the above synthetic DNA sequence was digested with Pst I and Eco RI, and then the resulting Pst I and Eco RI DNA fragments were substituted for the Pst I and Eco RI DNA fragments of pcDNA3-Sig/sE7/LAMP [23] ( Fig. 1 ). The plasmids used in this study were verified by DNA sequencing analysis. The plasmid DNA was produced in bacteria and purified by endotoxin-free Qiagen kits according to the manufacturer’s protocol (Qiagen, Valencia, CA). For DNA immunization, animals were injected intramuscularly (i.m.) at 0 and 2 weeks. The parameters of the injections were as follows: 50 μg per mouse of pB16 or pSig/B16/LAMP coding for the Trp2180–188, Trp1222–229 and gp10025–33 peptides; with or without 10 μg of IL-12 cDNA [24] ; final volume of 50 μl in PBS; 31-gauge needle (BD, Franklin Lakes, NJ). The injections were followed by intramuscular (IM)-electroporation (EP) using Cellectra® in accordance with the manufacturer’s protocol (VGX International Inc., Seoul, Korea). For peptide vaccination, the animals were immunized subcutaneously (s.c.) at 0 and 2 weeks. The parameters of these immunizations were as follows: 20 μg of each peptide (Trp2180–188, Trp1222–229, gp10025–33) per mouse; with or without 20 μg of CpG-ODN; final volume of 100 μl in PBS; 31-gauge needle (BD). Trp1, gp100, Trp2 and HPV 16 E7 peptides were purchased from Peptron (Taejon, Korea). The CpG-ODN [unmethylated form] designated as 1826 (5′-TCCATGACGTTCCTGACGTT-3′) was purchased from GenoTech, Taejon, Korea. It was synthesized with a nuclease-resistant phosphorothioate backbone, dissolved in water and then confirmed to have an undetectable endotoxin level. Poly (I:C) was purchased from Sigma–Aldrich (St. Louis, MO) and dissolved in water. Gardiquimod was purchased from Enzo Life Sciences (Plymouth Meeting, PA). Prior to use, it was dissolved first in dimethyl sulfoxide and then water at the volume ratio of 1:10.

gr1

Fig. 1 Construction of pB16 and pSig/B16/LAMP coding for three B16 melanoma peptides (Trp2180–188, Trp1222–229, and gp10025–33).

2.3. Anti-4.1BB Abs and animal treatment

When the tumors reached approximately 7 mm in mean diameter, the animals were injected intraperitoneally (i.p.) with 100 μg of anti-4.1BB Abs, generated from hybridoma cells (3H3), which were a kind gift of R. Mittler (Emory University, Atlanta, GA). Specifically, pristane-primed nude mice were injected with 3H3 cells for ascites fluid production from which anti-4.1BB Abs were purified using a protein G column (Sigma–Aldrich). Control rat immunoglobulin G (IgG) was purchased from Sigma–Aldrich.

2.4. IFN-γ assay

A 1 ml aliquot containing 6 × 106 splenocytes was added to each well of 24-well plates containing 1 or 5 μg of B16 melanoma-associated MHC class I peptides or HPV16 E7 CTL peptides as a control. After 3 days of incubation at 37 °C in 5% CO2, the cell supernatants were isolated and used to analyze IFN-γ levels using commercial cytokine kits (BD) by adding the extracellular fluids to IFN-γ-specific ELISA plates.

2.5. In vivo CTL lytic activity assay

Spleen cells from naïve mice were treated with red blood cell lysis buffer (Sigma). One fraction of the splenocytes was then pulsed with 5 μg of Trp2180–188 in cRPMI for 60 min at 37 °C, while the other fraction was left un-pulsed. To generate peptide-pulsed cells with high CFSE, the peptide-pulsed splenocytes were incubated with 20 μM CFSE in RPMI (2.5% FBS) for 15 min. The un-pulsed cells were instead incubated with 2.5 μM CFSE in RPMI (2.5% FBS) for 15 min to generate non-peptide-pulsed cells with low CFSE. The cells were then washed 3 times with PBS to remove unbound CFSE. Finally, an equal number of pulsed and un-pulsed cells (a total of 2 × 107 cells/0.4 ml/mouse) were injected intravenously (i.v.) into the tested mice. After 18 h, the mice were sacrificed and the spleens were collected. After lysing the red blood cells, the splenocytes were analyzed directly for the two cell populations with CFSE staining (CFSE low versus CFSE high) using a flow cytometer (BD). The percentage of lysed cells (%lysis) was calculated as 100 × [1 − (runprimed/rprimed)]. The ratio (r) was calculated as %CFSElow/%CFSEhigh.

2.6. Tetramer staining and flow cytometry

To test the levels of Ag-specific CD8+ T cells present in the tumor tissues, immune cells were isolated from the tumor tissues. Each tumor was put into 2 ml of cRMPI and cut into small pieces, which were subsequently broken using needle tips and then treated with collagenase (1.5 mg/ml) and DNase I (0.5 μg/ml) for 30 min. Ficoll-Hypaque separation was used to obtain the immune cell fraction. For the tetramer assay, the immune cells were incubated with FITC-labeled anti-CD8 Ab (BD) and PE-labeled tetramer/Trp2 peptides. PE-labeled tetramer/Trp2 peptides were kindly provided by E. Celis (Moffitt Cancer Research Center, Tampa). After washing three times with FACS buffer, the cells were analyzed to determine the percentage of tetramer and CD8 double positive T cells using a flow cytometer (BD). To analyze CD44 and CD8 double positive cell populations, the tumor-cured mice were sacrificed and the inguinal lymph nodes were removed for immune cell isolation. The isolated cells were incubated with APC-labeled anti-CD44 and PE-labeled anti-CD8 Abs (BD) for FACS analysis.

2.7. Immunohistofluorescence analysis

Tumor-bearing animals were sacrificed and the tumors were excised. The tumor mass was placed and frozen in Tissue-Tek OCT compound (Sakura Finetech, Torrance, CA). The embedded tumor tissues were cut into 4–5 μm sections and incubated with FITC-conjugated anti-mouse CD3 Abs (BD) and PE-conjugated anti-mouse CD8 Abs (BD). Fluorescence microscopy was used to identify the status of CD8+ T cell infiltration in the tumor tissues. Specially, the photos from each slide were aligned with the next slide to detect CD3 and CD8 double positive cells.

2.8. Tumor cell challenge

For the antitumor therapeutic studies, 5 × 105 B16 cells were injected s.c. into the right flank of C57BL/6 mice. When the mean tumor size was approximately 7 mm, the animals were injected s.c. with 20 μg of Trp2 peptides and 20 μg of CpG-ODN per mouse in a final volume of 100 μl PBS. The animals were also injected i.p. with 100 μg of anti-4.1BB Abs. The tumors required approximately 14 days to grow to 7 mm in size. For tumor re-challenge studies, 1 × 106 B16 cells per mouse were injected s.c. into the flank of C57BL/6 mice. The mice were monitored twice per week for tumor growth. The tumor size was measured in mm using a caliper, and was recorded as the mean diameter [longest surface length (a) and width (b), (a + b)/2]. The mice were euthanized when the mean diameter of the tumor exceeded 20 mm.

2.9. Statistical analysis

Statistical analysis was performed by one-way ANOVA using the SPSS 17.0 software program. The values of the experimental groups were compared with the values of the control group. Any p values < 0.05 were considered to be significant.

3. Results

3.1. Construction of Trp2, Trp1 and gp100 peptide-encoding plasmid DNAs, and comparison with peptide vaccines (Trp2, Trp1, gp100) adjuvanted with CpG-ODN for Ag-specific IFN-γ responses

To test whether the three B16 melanoma peptides (Trp2180–188, Trp1222–229 and gp10025–33) or the DNAs coding for the three peptides were immunogenic when co-injected with CpG-ODN or IL-12 plasmid DNAs (pIL-12), we immunized animals with 50 μg of either pB16 or pSig/B16/LAMP ( Fig. 1 ) per mouse with or without 10 μg pIL-12 by IM-EP or s.c. with the three peptides (20 μg each peptide/mouse) with or without CpG-ODN (20 μg/mouse). As seen in Fig. 2 , peptide-specific IFN-γ responses were not detected in immune cells from animals immunized with the three peptides in the absence of CpG-ODN when they were stimulated in vitro with each of the three peptides. When immune cells from animals immunized with the three peptides in the presence of CpG-ODN were stimulated in vitro with the Trp1222–229 and gp10025–33 peptides, they also failed to induce IFN-γ. However, when the same immune cells were stimulated in vitro with the Trp2180–188 peptides, they displayed Ag-specific IFN-γ production in an antigen dose-dependent manner, suggesting that only the Trp2180–188 peptide is immunogenic (in terms of IFN-γ responses) when co-injected with CpG-ODN (TLR9 agonist). In the case of DNA vaccines coding for the three peptides or targeting the 3 peptides into the lysosomal compartment, however, no IFN-γ response to the three peptides was observed. Similar results were also found when the DNA vaccines were co-injected with IL-12 cDNA. Overall, these data show that, among the tested peptides, the Trp2180–188 peptide is immunogenic when co-injected with the TLR9 agonist, CpG-ODN.

gr2

Fig. 2 Peptide-specific IFN-γ responses in animals immunized with the three B16 peptides, pB16 and pSig/B16/LAMP in combination with CpG-ODN or IL-12 cDNA. Each group (n = 5) of animals was either immunized s.c. with the three B16 peptides, Trp2180–188, Trp1222–229, and gp10025–33 (20 μg each peptide/mouse), with or without CpG-ODN (20 μg/mouse) at 0 and 2 weeks or injected i.m. with 50 μg of pB16 and pSig/B16/LAMP with or without pIL-12 (10 μg/mouse) at 0 and 2 weeks, followed by IM-EP. The animals were sacrificed at 4 weeks, and their splenocytes were isolated. The splenocytes were then stimulated in vitro with each of the three peptides. After 3 days of stimulation, the cell supernatants were collected and measured for IFN-γ levels. p < 0.05 compared to negative control.

3.2. Comparison of immunogenicity of Trp2180–188 peptides by co-injecting with poly (I:C), gardiquimod and CpG-ODN

TLRs are mainly expressed on antigen presenting cells (APCs). When APCs are stimulated with TLR agonists, they activate both the innate and adaptive immune system [25] and [26]. To investigate whether co-injection of Trp2 peptides with TLR ligands, such as poly (I:C) (for TLR3) and guadiquimod (for TLR7), might also induce Ag-specific IFN-γ responses, the animals were immunized s.c. with Trp2180–188 peptides in conjunction with increasing doses of TLR ligands. As shown in Fig. 3 A, immune cells from the animals immunized with Trp2 peptides plus poly (I:C) (20, 50 or 100 μg/mouse) showed little IFN-γ induction when they were stimulated in vitro with Trp2 peptides. A similar finding was also observed when the animals were immunized with Trp2 peptides plus gardiquimod (20, 50 or 100 μg/mouse) ( Fig. 3 B). However, immune cells from the animals immunized with Trp2 peptides plus CpG-ODN (20, 50 or 100 μg/mouse) produced IFN-γ in a CpG-ODN dose-dependent manner when they were stimulated in vitro with Trp2 peptides ( Fig. 3 C), suggesting that Trp2180–188 is only immunogenic when administered in combination with CpG-ODN but not with poly (I:C) or gardiquimod in this subcutaneous immunization model.

gr3

Fig. 3 TLR3, 7 and 9 ligands and their effects with Trp2 peptides on induction of Ag-specific IFN-γ responses. Each group (n = 5) of animals was immunized s.c. with 20 μg of Trp2180-188 per mouse in the presence of increasing doses (20, 50 and 100 μg/mouse) of poly (I:C), gardiquimod and CpG-ODN at 0 and 2 weeks in a final volume of 100 μl. The animals were sacrificed at 4 weeks, and their splenocytes were isolated. The splenocytes were then stimulated in vitro with Trp2180-188 or E7 control peptides. After 3 days of stimulation, the cell supernatants were collected and the IFN-γ levels were measured. p < 0.05 compared to negative control. ∗∗p < 0.05 compared to Trp2 + CpG-ODN (20 μg). ∗∗∗p < 0.05 compared to Trp2 + CpG-ODN (50 μg).

3.3. A TLR9 agonist, CpG-ODN, is effective at inducing Trp2-specific CTL lytic and antitumor therapeutic activity

We were next interested in testing whether immunization with Trp2180–188 peptides plus CpG-ODN might lead to the induction of Ag-specific CTL responses in vivo. As shown in Fig. 4 A–D, animals immunized with Trp2 peptides plus CpG-ODN induced Ag-specific CTL lytic activity in vivo. However, no such effects were observed when the animals were immunized with either Trp2 peptides or CpG-ODN alone. These data indicate that TLR9 stimulation by CpG-ODN is essential for the induction of Trp2-specific CTL responses in the B16 model. Fig. 4 E shows the antitumor therapeutic activity of treatments using Trp2 peptides and CpG-ODN. In this study, melanoma (7 mm in mean tumor size)-bearing animals showed a significant level of tumor growth inhibition over the time points measured following treatment with Trp2 peptides + CpG-ODN, compared to mice treated with either Trp2 peptides or CpG-ODN alone. Despite this antitumor effect, however, none of the mice displayed complete tumor regression. Taken together, these data clearly show that stimulation of TLR9 with CpG-ODN is critical for inducing Ag-specific CTL responses in the Trp2 peptide vaccine model, leading to antitumor therapeutic activity against large established melanoma.

gr4

Fig. 4 The effect of Trp2 peptides and CpG-ODN on the induction of Ag-specific CTL activity in vivo and overall antitumor therapeutic activity against large-established melanomas. (A–D) Each group (n = 5) of animals was immunized s.c. with 20 μg of Trp2 peptides and/or 20 μg of CpG-ODN per mouse in 100 μl of PBS at 0, 1 and 2 weeks. The animals were tested for in vivo CTL activity at 4 weeks. For this testing, Trp2 peptide-pulsed (CFSE high) and un-pulsed (CFSE low) splenocytes were injected i.v. into the immunized mice, as described in Section 2 . The next day, the mice were sacrificed and the splenocytes were analyzed by FACS to measure the levels of CFSE labeled cells in each subset. M1, un-pulsed CFSE low population; M2, Trp2-pulsed CFSE high population. A) PBS, B) Trp2 peptides, C) CpG-ODN, D) Trp2 peptide + CpG-ODN. The numbers inside each figure denote the mean CTL activity and SD. (E) Each group (n = 6–7) of mice was challenged s.c. with 5 × 105 B16 cells per mouse. When tumor sizes reached approximately 6 mm, the animals were injected s.c. with 100 μl of PBS containing 20 μg of Trp2 peptides per mouse and/or 20 μg of CpG-ODN per mouse at 0,1 and 2 weeks. Tumor sizes were measured over the entire time course, and mean tumor sizes were recorded. Values and bars represent the mean tumor sizes and the SD, respectively. p < 0.05 compared to negative control (PBS).

3.4. Additional stimulation of 4.1BB with anti-4.1BB Abs is essential for improving antitumor therapeutic effectiveness induced by Trp2 peptide vaccines

Previously, we observed that both Trp2 peptides and CpG-ODN were required for inducing both Ag-specific CD8+ CTL responses and antitumor therapeutic activity. 4.1BB stimulation has been reported to activate CD8+ T cells and prolong their life span [27] and [28]. In this context, we speculated that additional stimulation of 4.1BB with anti-4.1BB antibodies might augment the Ag-specific CD8+ CTL response that had been induced by Trp2 peptides plus CpG-ODN, thereby leading to increased antitumor therapeutic activity against large established melanomas. To test this hypothesis, we treated melanoma (7 mm)-bearing animals s.c. with Trp2 peptides+ CpG-ODN (henceforth called Trp2 peptide vaccines), and i.p. with anti-4.1BB Abs simultaneously. Of the six mice treated with Trp2 peptide vaccines plus anti-4.1BB Abs, five showed complete tumor regression ( Fig. 5 A). However, no mice treated with either Trp2 peptide vaccines or anti-4.1BB Abs alone showed such full tumor regression. Moreover, some of these mice also died 14 days post-treatment. However, animals treated with Trp2 peptide vaccines alone displayed significantly greater tumor growth inhibition over time than control groups, as we previously observed. In this case, however, a difference in tumor growth curves between Figs. 4 E and 5 A might be due to tumor sizes (6 versus 7 mm in mean diameter) when therapy was initiated. Another possibility is that this difference might be ascribed to the tumor cell passage number. For example, B16 cells at passage 2 were used for the Fig. 4 E study, while B16 cells at passage 6 were used for the Fig. 5 A study. However, the former is supported by our previous finding [29] . Overall, 9 of 12 (75%) tumor-bearing mice showed complete tumor regression after treatment with Trp2 peptide vaccines plus anti-4.1BB Abs, whereas none of the tumor-bearing mice (0%) displayed complete tumor regression after treatment with either Trp2 peptide vaccines or anti-4.1BB Abs alone ( Fig. 5 B). Furthermore, tumor-bearing mice treated with either Trp2 peptides or CpG-ODN in the presence of anti-4.1BB Abs failed to control tumor growth to the levels of animals treated with Trp2 peptides plus CpG-ODN in the presence of anti-4.1BB Abs ( Fig. 5 C). These data suggest that both Trp2 peptides and CpG-ODN are required for B16 melanoma control by anti-4.1BB Abs. To further evaluate immunological memory, some of the mice that rejected their tumors after treatment with Trp2 peptide vaccines plus anti-4.1BB Abs were re-challenged with B16 cells (68 days after the first treatment). As shown in Fig. 5 D, the average rate of tumor growth in the previously treated mice was significantly lower than that observed in the control naïve mice. Moreover, four-fifths (4/5) of the mice that had rejected tumors did not develop tumors after the re-challenge, indicating that some degree of immunological memory was generated by treatment with Trp2 peptide vaccines plus anti-4.1BB Abs. In another set of antitumor therapeutic studies, 4 of 6 tumor-bearing mice showed complete tumor regression after combined treatment with Trp2 peptides, CpG-ODN and anti-4.1BB Abs. Prior to B16 cell re-challenge, however, one mouse died for unknown reasons. The three remaining tumor-cured mice were re-challenged with B16 cells at 105 days following the first tumor cell challenge, along with age-matched naïve mice ( Fig. 5 E). As seen in Fig. 5 E, the previously tumor-cured mice formed significantly smaller tumors over time than naïve control mice. Thus, the data presented in Fig. 5 D and E demonstrates that the combined administration of Trp2 peptide vaccines plus anti-4.1BB Abs can induce long-term antitumor memory responses to parental B16 melanoma cells. Moreover, these tumor-cured mice showed significantly higher percentages (25%) of CD44highCD8+ T cells (as memory phenotypes), compared to naïve control mice (14%) ( Fig. 5 F). Taken together, these data collectively suggest that additional stimulation of 4.1BB with anti-4.1BB Abs is capable of augmenting both anti-melanoma therapeutic activity and long-term antitumor memory responses in this Trp2 peptide vaccine model.

gr5

Fig. 5 Augmentation of antitumor therapeutic activity and induction of long-term memory antitumor responses by concurrent treatment with Trp2 peptides + CpG-ODN + anti-4.1BB Abs. (A) Each group (n = 5–6) of mice was challenged s.c. with 5 × 105 B16 cells per mouse. When the tumor sizes reached approximately 7 mm, the animals were injected s.c. with 20 μg of Trp2 peptide vaccines + 20 μg of CpG-ODN per mouse in a final volume of 100 μl at 0,1 and 2 weeks. The animals were also injected i.p. with 100 μg of anti-4.1BB and control rat Abs at 0, 1 and 2 weeks. The tumor sizes were measured over the entire time course, and mean tumor sizes were recorded. Values and bars represent mean tumor sizes and the SD, respectively. The numbers in (/) denote the number of mice showing complete tumor regression at 65 days post-treatment/the number of mice tested. p < 0.05 compared to Trp2 + CpG-ODN + control Abs. (B) Percentage of mice showing complete tumor regression at 65 days following the first treatment. The numbers in (/) denote the number of mice showing complete tumor regression at 65 days post-treatment/the total number of mice tested in two separate studies. (C) Each group (n = 5) of mice was challenged and then tested as shown in Fig. 5 A except that either 20 μg of Trp2 peptides or 20 μg of CpG-ODN per mouse were s.c. injected in a final volume of 100 μl at 0,1 and 2 weeks. The animals were also injected i.p. with 100 μg of anti-4.1BB Abs at 0, 1 and 2 weeks. p < 0.05 compared to negative control. (D) Five tumor-cured animals from Fig. 5 A were re-challenged s.c. with 1 × 106 B16 cells per mouse at 68 days post-first treatment, along with age-matched naïve mice (n = 5). Tumor sizes were measured over the time points, and mean tumor sizes were recorded. Values and bars represent mean tumor sizes and the SD, respectively. (E) In another set of antitumor therapeutic experiments, 4 out of 6 tumor-bearing mice showed complete tumor regression after concurrent treatment with Trp2 peptide + CpG-ODN + anti-4.1BB Abs. Prior to tumor cell re-challenge, one of the 4 mice died for unknown reasons. Therefore, the remaining 3 tumor-cured mice were re-challenged s.c. with 1 × 106 B16 cells per mouse at 105 days after the first treatment, along with 5 age-matched naïve mice. The numbers in (/) denote the number of mice with tumors at 21–25 days post-tumor re-challenge/the number of mice tested. p < 0.05 compared to naive mice. (F) Each group (n = 5) of mice was challenged and then treated as shown in Fig. 5 A. The three animals showing complete tumor regression at 2 months post-treatment were sacrificed, and the inguinal lymph nodes were removed for immune cell isolation. The isolated cells were analyzed for the levels of CD44highCD8+ T cells using flow cytometry, compared to naïve control animals. The numbers at the top right indicate the percentage of CD44highCD8+ T cells and the SD, respectively. a, naïve control; b, tumor-cured mice.

3.5. Stimulation of 4.1BB with anti-4.1BB Abs is critical for augmenting Ag-specific CTL activity induced by Trp2 peptide vaccines

We were next interested in testing whether additional stimulation of 4.1BB with anti-4.1BB Abs might be able to augment Ag-specific CTL activity. To investigate this issue, we injected animals with Trp2 peptide vaccines (Trp2 peptides plus CpG-ODN) in combination with anti-4.1BB Abs and then evaluated the level of Ag-specific CTL activity in vivo. At this point, we reduced the number of immunizations to two, as three immunizations of Trp2 peptide vaccines resulted in an 82% induction of CTL lytic activity ( Fig. 4 D). As shown in Fig. 6 A–E, animals injected with Trp2 peptide vaccines showed 44% CTL activity while those with Trp2 peptide vaccines plus anti-4.1BB Abs showed 76% CTL activity, almost 1.5-fold increase in CTL activity following the addition of anti-4.1BB Abs. In contrast, control mice and mice treated with anti-4.1BB Abs alone exhibited a background level of CTL activity in vivo. Thus, these data show that additional stimulation of 4.1BB with anti-4.1BB Abs augments Ag-specific CTL activity to a dramatic degree in the Trp2 peptide vaccine model.

gr6

Fig. 6 Augmentation of Trp2-specific CTL activity in vivo by concurrent treatment with Trp2 peptides, CpG-ODN and anti-4.1BB Abs. Each group (n = 5) of mice was immunized s.c. with 100 μl of Trp2 peptide vaccines (20 μg of Trp2 peptide + 20 μg of CpG-ODN) per mouse at 0 and 1 weeks. Animals were also injected i.p. with 100 μg of anti-4.1BB Abs or control rat Abs at 0 and 1 weeks. After 4 days following the second injection, Trp2 peptide-pulsed (CFSE high) and un-pulsed (CFSE low) spleen cells were injected i.v. into the treated mice to determine CTL activity, as described in Section 2 . On the following day, the mice were sacrificed and the spleen cells were analyzed by FACS to determine the levels of CFSE labeled cells in each subset. M1, un-pulsed CFSE low population; M2, Trp2-pulsed CFSE high population. (A) negative control, (B) anti-4.1BB Abs, (C) Trp2 + CpG-ODN + control Abs, (D) Trp2 + CpG-ODN + anti-4.1BB Abs, (E) denotes mean %CTL lytic activity of each test group, and the SD. p < 0.05 compared to negative control. ∗∗p < 0.05 compared to Trp2 + CpG-ODN + control Abs.

3.6. Additional stimulation of 4.1BB with anti-4.1BB Abs is important for increasing the infiltration of Ag-specific CD8+ T cells into the tumor sites

To determine whether additional stimulation of 4.1BB with anti-4.1BB Abs might be able to increase the levels of Ag-specific CD8+ T cell infiltration into the tumor sites, tumor-bearing animals were treated with Trp2 peptide vaccines (Trp2 peptides + CpG-ODN) plus anti-4.1BB Abs, after which tumors were excised for FACS analysis. Fig. 7 shows the infiltration levels of Ag-specific CD8+ T cells in each tumor, as determined by tetramer staining. Tumor-bearing animals treated with anti-4.1BB Abs alone showed a higher degree of Ag-specific CD8+ T cell infiltration into the tumor tissues than negative controls. However, tumor-bearing animals treated with Trp2 peptide vaccines displayed significantly more infiltration of Ag-specific CD8+ T cells into the tumor sites than those treated with anti-4.1BB Abs alone, whereas tumor-bearing animals treated with Trp2 peptide vaccine plus anti-4.1BB Abs exhibited significantly more Ag-specific CD8+ T cell infiltration into the tumor tissues. Immunohistofluorescence staining further demonstrated that significantly more CD8+ T cells were present in the tumor tissues of animals treated with Trp2 peptides vaccines plus anti-4.1BB Abs than those with Trp2 peptides vaccines plus control Abs ( Fig. 8 ). Thus, these data demonstrate that additional stimulation of 4.1BB with anti-4.1BB Abs allows for more infiltration of Ag-specific CD8+ T cells into the tumor sites.

gr7

Fig. 7 Increased Infiltration of Trp2-specific CD8+ T cells into the melanoma tissues of tumor-bearing mice following treatment with Trp2 peptide, CpG-ODN and anti-4.1BB Abs. Each group (n = 5) of mice was challenged s.c. with 5 × 105 B16 cells per mouse. When tumor sizes reached 6-7 mm, the animals were injected with s.c. with 100 μl of Trp2 peptide vaccines (20 μg of Trp2 peptides + 20 μg of CpG-ODN) per mouse at 0 and 1 weeks. The animals were also treated i.p. with 100 μg of anti-4.1BB Abs and control Abs at 0 and 1 weeks. After 5 days following the second injection, the animals were sacrificed and the tumors were removed for immune cell isolation, as described in Section 2 . The isolated cells were stained using anti-CD8 and Trp2-tetramer and subsequently analyzed by FACS. (A) Negative control, (B) anti-4.1BB Abs, (C) Trp2 + CpG-ODN + control Abs, (D) Trp2 + CpG-ODN + anti-4.1BB Abs, (E) denotes %tetramer + CD8+ T cells among total leukocytes in tumor, and the SD. p < 0.05 compared to negative control. ∗∗p < 0.05 compared to Trp2 + CpG-ODN + control Abs.

gr8

Fig. 8 Increased infiltration of CD8+ T cells into the melanoma tissues of tumor-bearing mice following treatment with Trp2 peptide, CpG-ODN and anti-4.1BB Abs. Each group (n = 5) of mice was challenged with B16 cells and treated as shown in Fig. 7 . After 5 days following the second injection, the animals were sacrificed and the tumors were removed for immunohistofluorescence staining (200×), as described in Section 2 . Asterisks indicate CD3 and CD8 double positive T cells. (A) Negative control, (B) anti-4.1BB Abs, (C) Trp2 + CpG-ODN + control Abs, (D) Trp2 + CpG-ODN + anti-4.1BB Abs.

4. Discussion

In this study, we observed that, among the tested melanoma peptides, Trp2180–188 peptides were immunogenic only when co-injected with the TLR9 ligand, CpG-ODN. This is compatible with our recent finding that intratumoral treatment of melanoma with IL-12 cDNA induced Trp2180–188-specific CTL responses, which eradicated the tumor [30] . This is also consistent with a previous finding that delivery of liposome-encapsulated Trp2 peptides plus CpG-ODN allows for better anti-melanoma responses through the induction of Ag-specific CTL responses [31] . Davila et al. also reported that separate subcutaneous injections of Trp2 peptides and CpG-ODN are capable of inducing Ag-specific CTL responses capable of controlling melanoma in a B16 model [32] . In these models, CpG-ODN likely helps break immune tolerance to self-Trp2 peptides. CpG-ODN has been known to stimulate dendritic cells (DCs), causing their activation and maturation to professional APCs [33] . It also induces DCs to produce IL-12 and enhances their activation of CTLs [34] and [35]. Consistent with this, the adjuvant effects of CpG-ODN on Ag-specific CTL induction have also been demonstrated in the human papillomavirus 16 E7 protein vaccine models [36], [37], and [38]. Despite this positive effect of CpG-ODN, however, poly (I:C) (TLR5 agonist) and gardiquimod (TLR7 agonist) treatment failed to show any significant effect on Trp2-specific IFN-γ induction in our study. Gardiquimod has been reported to activate both the innate and adaptive arms of the immune response, and improve the antitumor effects of tumor lysate-loaded DCs in B16 melanoma [39] . The lack of Trp2-specific immune induction by gardiquimod in this study was unexpected, but might be explained by a recent finding that TLR7 stimulation might activate regulatory T cells, enhancing immune suppression [40] . In our study, Trp2 peptides injected subcutaneously in combination with poly (I:C) at concentrations as high as 100 μg per mouse failed to show any effects on the induction of Trp2-specific IFN-γ responses. These data are in contrast with the previous finding that poly (I:C) co-delivered intravenously with Trp2 peptides and anti-CD40 Abs can induce potent Trp2-specific CD8+ T cell responses [12] . In view of this and previous other data, it is highly likely that the delivery route (e.g., intravenous versus subcutaneous), and the usage of an antibody might cause the observed differences in the ability of poly (I:C) to regulate Ag-specific immune responses. However, the exact reasons for these differences are not yet understood. Furthermore, in the present study, animals injected with wild type and lysosomal targeting DNA vaccines coding for Trp2180–188, Trp1222–229 and gp10025–33 showed no IFN-γ response when their splenocytes were stimulated in vitro with each of the peptides, even in the presence of IL-12 cDNA, suggesting that the immune system is still tolerant of these melanoma self-peptides, in particular Trp2 peptides delivered in a DNA form that maintains immune tolerance and that additional stimulatory signals might be necessary for immune induction.

4.1BB stimulation can activate CD8+ T cells and prolong their life span by inducing the expression of anti-apoptotic molecules, such as bcl-Xl and Bfl-1 [27] and [28]. Anti-CD40 Abs and anti-CTLA4 Abs have been previously reported to be effective at modulating Trp2 peptide vaccine-mediated antitumor immunity in B16 melanoma models [12] and [32]. B16 melanoma tumors are also known to be eradicated by Ag-specific CD8+ T cells through the perforin/granzyme-mediated tumor cell killing pathway [12] and [30]. IFN-γ is required for the induction of MHC class I expression, which is essential for melanoma cell killing by Ag-specific CD8+ CTL [30] and [41]. In the present study, we observed that concurrent administration of anti-4.1BB Abs and Trp2 peptide vaccines (Trp2 peptides plus CpG-ODN) resulted in a 75% complete tumor regression rate against large established melanoma tumors (7 mm). However, such an effect was not observed without the addition of anti-4.1BB Abs. Even with this, we observed that Trp2 peptide plus CpG-ODN were more effective at inhibiting tumor growth over the time points than either treatment alone. We also observed that subcutaneous delivery of either Trp2 peptides or CpG-ODN alone, even in the presence of systemic delivery of anti-4.1BB Abs, induced no significant tumor growth suppression in this model, highlighting that the induction of Ag-specific CD8+ T cells is likely a prerequisite for the observed positive effect of anti-4.1BB Abs. These findings underscore the notion that, in the Trp2 peptide model, both combined stimulation of TLR9 with CpG-ODN and 4.1BB with anti-4.1BB Abs are critical for eliciting a level of Ag-specific CD8+ CTL activity that can eradicate large established tumors. Along with the antitumor effectiveness, we also observed a degree of long-term antitumor memory against parental B16 melanoma cells in the tumor-cured mice. In parallel with this antitumor activity, mice injected with Trp2 peptides + CpG-ODN + anti-4.1BB Abs displayed dramatically more Ag-specific CTL activity in vivo than those not treated with anti-4.1BB Abs. Similarly, tumor-bearing animals treated with Trp2 peptides + CpG-ODN + anti-4.1BB Abs displayed dramatically more infiltration by Ag-specific CD8+ T cells into the tumor sites than those not treated with anti-4.1BB Abs. Therefore, it is likely that animals can break immune tolerance to a self-antigen, Trp2, when co-injected with Trp2 peptides plus CpG-ODN through TLR9 stimulation of APCs and can then induce Trp2-specific CD8+ T cells. These Trp2-specific CD8+ T cells are then likely further activated by the addition of agonistic anti-4.1BB Abs through 4.1BB signaling. This notion is further supported by our in vitro data, which show that when immune cells from animals immunized with Trp2 peptides plus CpG-ODN were stimulated in vitro with Trp2 peptides, but not with control E7 peptides, they induced IFN-γ production in an anti-4.1BB antibody dose-dependent fashion (data not shown). It is also possible that the augmentation of antitumor therapeutic activity by anti-4.1BB Abs might be associated with the suppressive functions of regulatory T cells by anti-4.1BB Abs. This notion is supported by the recent finding [42] .

In summary, our data showed that combined stimulation of TLR9 with CpG-ODN and 4.1BB with anti-4.1BB Abs is essential for achieving Trp2 peptide vaccine-mediated melanoma eradication. This effect appeared to be mediated by the increased induction of Ag-specific CTLs and their subsequent infiltration into the tumor sites. Therefore, these results indicate that peptide vaccination of tumor-bearing mice, in combination with a strong adjuvant and 4.1BB stimulation, is capable of eliciting potent antitumor CTL responses that lead to tumor regression. These findings could have clinical implications with regard to designing peptide-based therapeutic vaccines for patients with cancer.

Acknowledgments

We wish to appreciate VGX International Inc./Inovio for providing Cellectra® for this study. This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2010-0008060).

References

  • [1] Y. Li, E.F. McClay. Systemic chemotherapy for the treatment of metastatic melanoma. Semin. Oncol.. 2002;29:413-426
  • [2] E. Bajetta, M. Del Vecchio, C. Bernard-Marty, M. Vitali, R. Buzzoni, O. Rixe, P. Nova, S. Aglione, S. Taillibert, D. Khayat. Metastatic melanoma: chemotherapy. Semin. Oncol.. 2002;29:427-445 Crossref
  • [3] S.A. Rosenberg, P. Spiess, R. Lafreniere. A new approach to the adoptive immunotherapy of cancer with tumor-infiltrating lymphocytes. Science. 1986;233:1318-1321
  • [4] M.E. Dudley, S.A. Rosenberg. Adoptive-cell-transfer therapy for the treatment of patients with cancer. Nat. Rev. Cancer. 2003;3:666-675 Crossref
  • [5] P.F. Robbins, A. Sette, E. Appella, S.A. Rosenberg. Recognition of multiple epitopes in the human melanoma antigen gp100 by tumor-infiltrating T lymphocytes associated with in vivo tumor regression. J. Immunol.. 1995;154:3961-3968
  • [6] R.F. Wang, E. Appella, Y. Kawakami, X. Kang, S.A. Rosenberg. Identification of TRP-2 as a human tumor antigen recognized by cytotoxic T lymphocytes. J. Exp. Med.. 1996;184:2207-2216 Crossref
  • [7] M.B. Bloom, D. Perry-Lalley, P.F. Robbins, Y. Li, M. el-Gamil, S.A. Rosenberg, J.C. Yang. Identification of tyrosinase-related protein 2 as a tumor rejection antigen for the B16 melanoma. J. Exp. Med.. 1997;185:453-459
  • [8] S.E. Finkelstein, D.M. Heimann, C.A. Klebanoff, P.A. Antony, L. Gattinoni, C.S. Hinrichs, L.N. Hwang, D.C. Palmer, P.J. Spiess, D.R. Surman, C. Wrzesiniski, Z. Yu, S.A. Rosenberg, N.P. Restifo. Bedside to bench and back again: how animal models are guiding the development of new immunotherapies for cancer. J. Leukoc. Biol.. 2004;76:333-337 Crossref
  • [9] J.A. Guevara-Patiño, M.E. Engelhorn, M.J. Turk, C. Liu, F. Duan, G. Rizzuto, A.D. Cohen, T. Merghoub, J.D. Wolchok, A.N. Houghton. Optimization of a self antigen for presentation of multiple epitopes in cancer immunity. J. Clin. Invest.. 2006;116:1382-1390
  • [10] P. Nava-Parada, G. Forni, K.L. Knutson, L.R. Pease, E. Celis. Peptide vaccine given with a Toll-like receptor agonist is effective for the treatment and prevention of spontaneous breast tumors. Cancer Res.. 2007;67:1326-1334 Crossref
  • [11] D.E. Speiser, D. Liénard, N. Rufer, V. Rubio-Godoy, D. Rimoldi, F. Lejeune, A.M. Krieg, J.C. Cerottini, P. Romero. Rapid and strong human CD8+ T cell responses to vaccination with peptide, IFA, and CpG oligodeoxynucleotide 7909. J. Clin. Invest.. 2005;115:739-746
  • [12] H. Cho, E. Celis. Optimized peptide vaccines eliciting extensive CD8 T-cell responses with therapeutic antitumor effects. Cancer Res.. 2009;69:9012-9019 Crossref
  • [13] X. Zhu, F. Nishimura, K. Sasaki, M. Fujita, J.E. Dusak, J. Eguchi, W. Fellows-Mayle, W.J. Storkus, P.R. Walker, A.M. Salazar, H. Okada. Toll like receptor-3 ligand poly-ICLC promotes the efficacy of peripheral vaccinations with tumor antigen-derived peptide epitopes in murine CNS tumor models. J. Transl. Med.. 2007;5:10 Crossref
  • [14] K.E. Pollok, Y.J. Kim, Z. Zhou, J. Hurtado, K.K. Kim, R.T. Pickard, B.S. Kwon. Inducible T cell antigen 4-1BB. Analysis of expression and function. J. Immunol.. 1993;150:771-781
  • [15] J.C. Hurtado, S.H. Kim, K.E. Pollok, Z.H. Lee, B.S. Kwon. Potential role of 4-1BB in T cell activation. Comparison with the costimulatory molecule CD28. J. Immunol.. 1995;155:3360-3367
  • [16] W.W. Shuford, K. Klussman, D.D. Tritchler, D.T. Loo, J. Chalupny, A.W. Siadak, T.J. Brown, J. Emswiler, H. Raecho, C.P. Larsen, T.C. Pearson, J.A. Ledbetter, A. Aruffo, R.S. Mittler. 4-1BB costimulatory signals preferentially induce CD8+ T cell proliferation and lead to the amplification in vivo of cytotoxic T cell responses. J. Exp. Med.. 1997;186:47-55 Crossref
  • [17] E. Kocak, K. Lute, X. Chang, K.F. May, K.R. Exten, H. Zhang, S.F. Abdessalam, A.M. Lehman, D. Jarjoura, P. Zheng, Y. Liu. Combination therapy with anti-CTL antigen-4 and anti-4-1BB antibodies enhances cancer immunity and reduces autoimmunity. Cancer Res.. 2006;66:7276-7284 Crossref
  • [18] B. Li, J. Lin, M. Vanroey, M. Jure-Kunkel, K. Jooss. Established B16 tumors are rejected following treatment with GM-CSF-secreting tumor cell immunotherapy in combination with anti-4-1BB mAb. Clin. Immunol.. 2007;125:76-87 Crossref
  • [19] V.Y. Taraban, T.F. Rowley, L. O’Brien, H.T. Chan, L.E. Haswell, M.H. Green, A.L. Tutt, M.J. Glennie, A. Al-Shamkhani. Expression and costimulatory effects of the TNF receptor superfamily members CD134 (OX40) and CD137 (4–1BB), and their role in the generation of anti-tumor immune responses. Eur. J. Immunol.. 2002;32:3617-3627 Crossref
  • [20] G. Zheng, B. Wang, A. Chen. The 4–1BB costimulation augments the proliferation of CD4+CD25+ regulatory T cells. J. Immunol.. 2004;173:2428-2434 Crossref
  • [21] I. Melero, W.W. Shuford, S.A. Newby, A. Aruffo, J.A. Ledbetter, K.E. Hellstrom, R.S. Mittler, L. Chen. Monoclonal antibodies against the 4–1BB T-cell activation molecule can eradicate established tumors. Nat. Med.. 1997;3:682-685 Crossref
  • [22] L.B. John, L.J. Howland, J.K. Flynn, A.C. West, C. Devaud, C.P. Duong, T.J. Stewart, J.A. Westwood, Z.S. Guo, D.L. Bartlett, M.J. Smyth, M.H. Kershaw, P.K. Darcy. Oncolytic virus and anti-4-1BB combination therapy elicits strong antitumor immunity against established cancer. Cancer Res.. 2012;72:1651-1660 Crossref
  • [23] M.S. Kim, J.I. Sin. Both antigen optimization and lysosomal targeting are required for enhanced anti-tumour protective immunity in a human papillomavirus E7-expressing animal tumour model. Immunology. 2005;116:255-266
  • [24] J.I. Sin. Suppression of antitumor protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 cDNA: involvement of nitric oxide in immune suppression. Immunology. 2009;128:e707-e717 Crossref
  • [25] S. Akira, S. Uematsu, O. Takeuchi. Pathogen recognition and innate immunity. Cell. 2006;124:783-801 Crossref
  • [26] R. Medzhitov. Recognition of microorganisms and activation of the immune response. Nature. 2007;449:819-826 Crossref
  • [27] D. Cooper, P. Bansal-Pakala, M. Croft. 4–1BB (CD137) controls the clonal expansion and survival of CD8 T cells in vivo but does not contribute to the development of cytotoxicity. Eur. J. Immunol.. 2002;32:521-529 Crossref
  • [28] H.-W. Lee, S.-J. Park, B.K. Choi, H.H. Kim, K.-O. Nam, B.S. Kwon. 4–1BB promotes the survival of CD8+ T lymphocytes by increasing expression of Bcl-xL and Bfl-11. J. Immunol.. 2002;169:4882-4888 Crossref
  • [29] J.I. Sin, J.M. Kim, S.H. Bae, I.H. Lee, J.S. Park, H.M. Ryoo. Adoptive transfer of human papillomavirus E7-specific CTL enhances tumor chemoresponse through the perforin/granzyme-mediated pathway. Mol. Ther.. 2009;17:906-913 Crossref
  • [30] J.I. Sin, J.B. Park, I.H. Lee, D. Park, Y.S. Choi, J. Choe, E. Celis. Intratumoral electroporation of IL-12 cDNA eradicates established melanomas by Trp2180-188-specific CD8+ CTLs in a perforin/granzyme-mediated and IFN- γ dependent manner: application of Trp2180-188 peptides. Cancer Immunol. Immunother.. 2012;61:1671-1682 Crossref
  • [31] V. Jérôme, A. Graser, R. Müller, R.E. Kontermann, A. Konur. Cytotoxic T lymphocytes responding to low dose TRP2 antigen are induced against B16 melanoma by liposome-encapsulated TRP2 peptide and CpG DNA adjuvant. J. Immunother.. 2006;29:294-305
  • [32] E. Davila, R. Kennedy, E. Celis. Generation of antitumor immunity by cytotoxic T lymphocyte epitope peptide vaccination, CpG-oligodeoxynucleotide adjuvant, and CTLA-4 blockade. Cancer Res.. 2003;63:3281-3288
  • [33] T. Sparwasser, E.S. Koch, R.M. Vabulas, K. Heeg, G.B. Lipford, J.W. Ellwart, H. Wagner. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol.. 1998;28:2045-2054 Crossref
  • [34] T.G. Kim, C.H. Kim, E.H. Won, S.M. Bae, W.S. Ahn, J.B. Park, J.I. Sin. CpG-ODN-stimulated dendritic cells act as a potent adjuvant for E7 protein delivery to induce antigen-specific anti-tumor immunity in a HPV 16 (E6/E7)-associated tumor animal model. Immunology. 2004;112:117-125 Crossref
  • [35] T.L. Warren, S.K. Bhatia, A.M. Acosta, C.E. Dahle, T.L. Ratliff, A.M. Krieg, G.J. Weiner. APC stimulated by CpG oligodeoxynucleotide enhance activation of MHC class I-restricted T cells. J. Immunol.. 2000;165:6244-6251 Crossref
  • [36] T.Y. Kim, H.J. Myoung, J.H. Kim, I.S. Moon, T.G. Kim, W.S. Ahn, J.I. Sin. Both E7 and CpG-ODN are required for protective immunity against challenge with human papillomavirus 16 (E6/E7)-immortalized tumor cells: involvement of CD4+ and CD8+ T cells in protection. Cancer Res.. 2002;62:7234-7240
  • [37] S.H. Bae, Y.J. Park, Y.S. Choi, J.B. Park, M.S. Kim, J.I. Sin. Therapeutic synergy of human papillomavirus E7 subunit vaccines plus cisplatin in an animal tumor model: causal involvement of increased sensitivity of cisplatin-treated tumors to CTL-mediated killing in therapeutic synergy. Clin. Cancer Res.. 2007;13:341-349 Crossref
  • [38] G.W. Ye, J.B. Park, Y.J. Park, Y.S. Choi, J.I. Sin. Increased sensitivity of radiated murine cervical cancer tumors to E7 subunit vaccine-driven CTL-mediated killing induces synergistic antitumor activity. Mol. Ther.. 2007;15:1564-1570 Crossref
  • [39] F. Ma, J. Zhang, C. Zhang. The TLR7 agonists imiquimod and gardiquimod improve DC-based immunotherapy for melanoma in mice. Cell. Mol. Immunol.. 2010;7:381-388 Crossref
  • [40] N. Forward, S.J. Furlong, Y. Yang, T.J. Lin, D.W. Hoskin. Signaling through TLR7 enhances the immunosuppressive activity of murine CD4+CD25+ T regulatory cells. J. Leukoc. Biol.. 2010;87:117-125 Crossref
  • [41] S. Amos, H.J. Pegram, J.A. Westwood, L.B. John, C. Devaud, C.J. Clarke, N.P. Restifo, M.J. Smyth, P.K. Darcy, M.H. Kershaw. Adoptive immunotherapy combined with intratumoral TLR agonist delivery eradicates established melanoma in mice. Cancer Immunol Immunother.. 2011;60:671-683 Crossref
  • [42] S.E. Smith, D.B. Hoelzinger, A.L. Dominguez, J. Van Snick, J. Lustgarten. Signals through 4-1BB inhibit T regulatory cells by blocking IL-9 production enhancing antitumor responses. Cancer Immunol. Immunother.. 2011;60:1775-1787 Crossref

Footnotes

a Department of Microbiology, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do 200-701, Republic of Korea

b Department of Radiology, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do 200-701, Republic of Korea

c Department of Physiology, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do 200-701, Republic of Korea

d Department of Plastic & Reconstructive Surgery, School of Medicine, Kangwon National University, Chuncheon, Gangwon-do 200-701, Republic of Korea

e School of Biological Sciences, University of Ulsan, Ulsan 680-749, Republic of Korea

lowast Corresponding author. Tel.: +33 250 8861; fax: +33 255 8809.